caption a7 growth Search Results


96
ATCC caption a7 growth
Caption A7 Growth, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caption a7 growth/product/ATCC
Average 96 stars, based on 1 article reviews
caption a7 growth - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp il4 bt03211898 m1
Real-time PCR bovine cytokine gene target sequences a
Gene Exp Il4 Bt03211898 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp il4 bt03211898 m1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp il4 bt03211898 m1 - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

93
ATCC caption a7 growth curves
Real-time PCR bovine cytokine gene target sequences a
Caption A7 Growth Curves, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caption a7 growth curves/product/ATCC
Average 93 stars, based on 1 article reviews
caption a7 growth curves - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Thermo Fisher l15+glutamax
Variation in Composition of Media for Zebrafish Cell Culture
L15+Glutamax, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/l15+glutamax/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
l15+glutamax - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp egfr rn00580398 m1
Primer sets used in RT-PCR
Gene Exp Egfr Rn00580398 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp egfr rn00580398 m1/product/Thermo Fisher
Average 88 stars, based on 1 article reviews
gene exp egfr rn00580398 m1 - by Bioz Stars, 2026-04
88/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp tgfb1 hs00998133 m1
TaqMan gene expression assays
Gene Exp Tgfb1 Hs00998133 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp tgfb1 hs00998133 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp tgfb1 hs00998133 m1 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

90
Cell Signaling Technology Inc growth factor function gdnf
Summary of growth factors and their neuroprotective functions.
Growth Factor Function Gdnf, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/growth factor function gdnf/product/Cell Signaling Technology Inc
Average 90 stars, based on 1 article reviews
growth factor function gdnf - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Unigene gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m
Venn diagrams comparing the number of genes induced by <t>PACAP,</t> <t>forskolin,</t> <t>dbcAMP,</t> and/or <t>NGF</t> in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).
Gene Name Unigene Number Genbank Id Pacap Forskolin Dbcamp Ngf Av S.E.M, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m/product/Unigene
Average 90 stars, based on 1 article reviews
gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp 18s hs99999901 s1
List of genes and gene expression IDs
Gene Exp 18s Hs99999901 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp 18s hs99999901 s1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp 18s hs99999901 s1 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

93
Cell Signaling Technology Inc caption a7 ingenuity pathways log
List of genes and gene expression IDs
Caption A7 Ingenuity Pathways Log, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caption a7 ingenuity pathways log/product/Cell Signaling Technology Inc
Average 93 stars, based on 1 article reviews
caption a7 ingenuity pathways log - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

96
Gilead Sciences caption a7 vegf inhibitor mechanism advantages subjects references macugen
<t> VEGF </t> INHIBITORS
Caption A7 Vegf Inhibitor Mechanism Advantages Subjects References Macugen, supplied by Gilead Sciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/caption a7 vegf inhibitor mechanism advantages subjects references macugen/product/Gilead Sciences
Average 96 stars, based on 1 article reviews
caption a7 vegf inhibitor mechanism advantages subjects references macugen - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
Unigene gene name
Venn diagrams comparing the number of genes induced by <t>PACAP,</t> <t>forskolin,</t> <t>dbcAMP,</t> and/or <t>NGF</t> in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).
Gene Name, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene name/product/Unigene
Average 90 stars, based on 1 article reviews
gene name - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Real-time PCR bovine cytokine gene target sequences a

Journal: Infection and Immunity

Article Title: Divergent Antigen-Specific Cellular Immune Responses during Asymptomatic Subclinical and Clinical States of Disease in Cows Naturally Infected with Mycobacterium avium subsp. paratuberculosis

doi: 10.1128/IAI.00650-19

Figure Lengend Snippet: Real-time PCR bovine cytokine gene target sequences a

Article Snippet: All reactions were performed in triplicate, and data were analyzed with the 2 − Δ Δ C T method. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Cytokine Target sequence Assay ID IL-4 CTTGGCAAGCAAGACCTGTTCTGTG Bt03211898_m1 IL-10 CTGGATGACTTTAAGGGTTACCTGG Bt03212725_m1 IL-12A GCTACAGAAGGCCAGACAAACTCTA Bt03213918_g1 IL-17A ACTTCATCTATGTCACTGCTACTGC Bt03210251_m1 IL-18 ATTGTTTCCTTTAAGGAAATGAATC Bt03212733_m1 IL-23 AACAGTCAGTCCTGCTTGCAAAGAA Bt04284624_m1 IFN-γ ATTGGAAAGATGAAAGTGACAAAAA Bt03212722_g1 TGF-β ACCCGCAGAGAGGAAATAGAGGGCT Bt04259486_m1 iNOS CAGCCCCCGTCCAGTCCAGTGACAC Bt03249590_m1 RANTES CTCCATGGCAGCAGTTGTCTTTATC Bt03216832_m1 Open in a separate window a Gene expression assays from Life Technologies (Grand Island, NY).

Techniques: Real-time Polymerase Chain Reaction, Sequencing

Variation in Composition of Media for Zebrafish Cell Culture

Journal: Zebrafish

Article Title: Deriving Cell Lines from Zebrafish Embryos and Tumors

doi: 10.1089/zeb.2013.0866

Figure Lengend Snippet: Variation in Composition of Media for Zebrafish Cell Culture

Article Snippet: Materials Composition of all used solutions and media is listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Growth media L15+GlutaMax (Gibco) 500 mL FBS (Sigma-Aldrich) 15% Calcium chloride 0.8 mM Penicillin (Gibco) 50 U/mL Streptomycin (Gibco) 0.05 mg/mL Gentamycin (Gibco) 10 mg/mL Calcium-free Ringer NaCl 2 116 mM KCl 2.9 mM HEPES 5 mM Bleaching solution NaOCl in calcium free Ringer 10%–13% Phosphate-buffered saline Na 2 HPO 4 10 mM KH 2 PO 4 1.5 mM NaCl 137 mM KCl 2.7 mM Open in a separate window KCl, potassium chloride; NaOCl, sodium hypochlorite; Na 2 HPO 4 , disodium phosphate; KH 2 PO 4 , monopotassium phosphate; NaCl, sodium chloride.

Techniques:

Media Composition

Journal: Zebrafish

Article Title: Deriving Cell Lines from Zebrafish Embryos and Tumors

doi: 10.1089/zeb.2013.0866

Figure Lengend Snippet: Media Composition

Article Snippet: Materials Composition of all used solutions and media is listed in . table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Growth media L15+GlutaMax (Gibco) 500 mL FBS (Sigma-Aldrich) 15% Calcium chloride 0.8 mM Penicillin (Gibco) 50 U/mL Streptomycin (Gibco) 0.05 mg/mL Gentamycin (Gibco) 10 mg/mL Calcium-free Ringer NaCl 2 116 mM KCl 2.9 mM HEPES 5 mM Bleaching solution NaOCl in calcium free Ringer 10%–13% Phosphate-buffered saline Na 2 HPO 4 10 mM KH 2 PO 4 1.5 mM NaCl 137 mM KCl 2.7 mM Open in a separate window KCl, potassium chloride; NaOCl, sodium hypochlorite; Na 2 HPO 4 , disodium phosphate; KH 2 PO 4 , monopotassium phosphate; NaCl, sodium chloride.

Techniques:

Primer sets used in RT-PCR

Journal: The Journal of Neuroscience

Article Title: Neural Stem/Progenitor Cells Participate in the Regenerative Response to Perinatal Hypoxia/Ischemia

doi: 10.1523/JNEUROSCI.1898-05.2006

Figure Lengend Snippet: Primer sets used in RT-PCR

Article Snippet: Only those genes that were induced or repressed at least twofold in each replication are listed in supplemental (available at www.jneurosci.org as supplemental material ). table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Transcript Primers EGFR (TaqMan) Applied Biosystems TaqMan Assay ID Rn00580398_m1 Notch1 (Lux) 5′-CAC GTA CTG CGA GCT GCC CTA CG[FAM]G-3′ 5′-GGC AGG TGC CTC CGT TCT-3′ 18S (TaqMan) Applied Biosystems TaqMan Assay ID Hs99999901_s1 18S (Lux) Invitrogen catalog #115HM-01 Open in a separate window Primer sets used in RT-PCR

Techniques: TaqMan Assay

Signaling pathways involved in control of NSP fate are induced by perinatal H/I. Ipsilateral H/I and control hemispheres were dissected out after 48 h of recovery. A, Total RNA was isolated and amplified by qRT-PCR using primers specific for EGFR and Notch1 and normalized to expression of 18S. Values in parentheses indicate CV for the target gene in the sample groups; n = 10 for ipsilateral and contralateral conditions, and n = 4 for sham condition. *p < 0.05 versus sham; †p < 0.05 versus contralateral by pairwise fixed reallocation randomization. Immunostaining for Notch1 was performed on cryostat sections from H/I (B) and control (C) animals. In situ hybridization was performed on cryostat sections of contralateral (D, G), ipsilateral (E, H), and control (F, I) hemispheres using a digoxigenin-labeled RNA probe for Hes5 (D–F) and Hes1 (G–I). Arrows in E delineate the region of increased Hes5 expression. Inset in E shows high-magnification 100× Nomarski image of the Hes5+ region showing a subependymal Hes5+ cell body (arrowhead) with processes (arrow) projecting through the ependyma. There was no evident change in Hes1 expression. Scale bars: inset in E, 4 μm; F, 10 μm. cp, Choroid plexus; V, ventricle.

Journal: The Journal of Neuroscience

Article Title: Neural Stem/Progenitor Cells Participate in the Regenerative Response to Perinatal Hypoxia/Ischemia

doi: 10.1523/JNEUROSCI.1898-05.2006

Figure Lengend Snippet: Signaling pathways involved in control of NSP fate are induced by perinatal H/I. Ipsilateral H/I and control hemispheres were dissected out after 48 h of recovery. A, Total RNA was isolated and amplified by qRT-PCR using primers specific for EGFR and Notch1 and normalized to expression of 18S. Values in parentheses indicate CV for the target gene in the sample groups; n = 10 for ipsilateral and contralateral conditions, and n = 4 for sham condition. *p < 0.05 versus sham; †p < 0.05 versus contralateral by pairwise fixed reallocation randomization. Immunostaining for Notch1 was performed on cryostat sections from H/I (B) and control (C) animals. In situ hybridization was performed on cryostat sections of contralateral (D, G), ipsilateral (E, H), and control (F, I) hemispheres using a digoxigenin-labeled RNA probe for Hes5 (D–F) and Hes1 (G–I). Arrows in E delineate the region of increased Hes5 expression. Inset in E shows high-magnification 100× Nomarski image of the Hes5+ region showing a subependymal Hes5+ cell body (arrowhead) with processes (arrow) projecting through the ependyma. There was no evident change in Hes1 expression. Scale bars: inset in E, 4 μm; F, 10 μm. cp, Choroid plexus; V, ventricle.

Article Snippet: Only those genes that were induced or repressed at least twofold in each replication are listed in supplemental (available at www.jneurosci.org as supplemental material ). table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Transcript Primers EGFR (TaqMan) Applied Biosystems TaqMan Assay ID Rn00580398_m1 Notch1 (Lux) 5′-CAC GTA CTG CGA GCT GCC CTA CG[FAM]G-3′ 5′-GGC AGG TGC CTC CGT TCT-3′ 18S (TaqMan) Applied Biosystems TaqMan Assay ID Hs99999901_s1 18S (Lux) Invitrogen catalog #115HM-01 Open in a separate window Primer sets used in RT-PCR

Techniques: Protein-Protein interactions, Control, Isolation, Amplification, Quantitative RT-PCR, Expressing, Immunostaining, In Situ Hybridization, Labeling

TaqMan gene expression assays

Journal: Inflammatory Intestinal Diseases

Article Title: Hypoxia Reduces the Transcription of Fibrotic Markers in the Intestinal Mucosa

doi: 10.1159/000513061

Figure Lengend Snippet: TaqMan gene expression assays

Article Snippet: Relative mRNA expression was determined by the comparative ∆∆Ct method using beta-actin (ACTB) as the reference gene. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene Full name TaqMan assay ID Human genes TGFβ Transforming growth factor beta Hs00998133_m1 ACTA2 Actin alpha 2, smooth muscle Hs00426835_g1 VIM Vimentin Hs00185584_m1 CDH1 Cadherin 1 Hs01023895_m1 CDH2 Cadherin 2 Hs00983056_m1 COL1A1 Collagen type I alpha 1 chain Hs00164004_m1 COL3A1 Collagen type III alpha 1 chain Hs00943809_m1 COL4A1 Collagen type IV alpha 1 chain Hs00266237_m1 MMP2 Matrix metallopeptidase 2 Hs01548727_m1 MMP3 Matrix metallopeptidase 3 Hs00968305_m1 MMP9 Matrix metallopeptidase 9 Hs00957562_m1 TIMP1 Tissue inhibitor of metalloproteinase 1 Hs01092512_g1 Mouse genes TGFβ Transforming growth factor beta Mm00524541_m1 ACTA2 Actin alpha 2, smooth muscle Mm00725412_s1 VIM Vimentin Mm01333430_m1 CDH1 Cadherin 1 Mm01247357_m1 CDH2 Cadherin 2 Mm01162497_m1 COL1A1 Collagen type I alpha 1 chain Mm00801666_g1 COL3A1 Collagen type III alpha 1 chain Mm00802300_m1 COL4A1 Collagen type IV alpha 1 chain Mm01210125_m1 MMP2 Matrix metallopeptidase 2 Mm00439498_m1 MMP3 Matrix metallopeptidase 3 Mm00440295_m1 MMP9 Matrix metallopeptidase 9 Mm00442991_m1 MMP13 Matrix metallopeptidase 13 Mm00439491_m1 TIMP1 Tissue inhibitor of metalloproteinase 1 Mm01341361_m1 Open in a separate window TaqMan gene expression assays Western Blot Total protein was harvested in M-PER lysis buffer (Thermo Fisher Scientific) supplemented with protease inhibitors (Roche Diagnostics, Mannheim, Germany).

Techniques: Gene Expression, TaqMan Assay

Summary of growth factors and their neuroprotective functions.

Journal: Expert review of neurotherapeutics

Article Title: Growth factor therapy sequesters inflammation in affording neuroprotection in cerebrovascular diseases

doi: 10.1080/14737175.2016.1184086

Figure Lengend Snippet: Summary of growth factors and their neuroprotective functions.

Article Snippet: *We recognize that there are multiple secondary cell death pathways, but we focus on the inflammation pathway because of its wide therapeutic window, which is the main of this paper. table ft1 table-wrap mode="anchored" t5 caption a7 Growth Factor Function GDNF Neuroprotection, regulate inflammation, Differentiation, proliferation, migration, neurite outgrowth and synaptic plasticity VEGF Angiogenesis and neuroprotection SDF-1 Cell signaling, anti-inflammation, anti-apoptosis, migration, and chemotaxis SCF Differentiation, neurogenesis, neuroprotection, chemotaxis, and Migration BDNF Neuronal survival, synaptic function, anti-inflammation, and anti-apoptosis Open in a separate window Summary of growth factors and their neuroprotective functions.

Techniques: Migration, Chemotaxis Assay

Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques:

Genes induced by at least one factor,  PACAP,   forskolin,   dbcAMP,  and/or  NGF  Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced by at least one factor, PACAP, forskolin, dbcAMP, and/or NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Ubiquitin Proteomics, Activation Assay, Sequencing, Virus

Genes induced in presence of  NGF  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced in presence of NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Derivative Assay, Ubiquitin Proteomics, Wilms Tumor Assay, Sequencing

Genes induced only by  PACAP  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced only by PACAP Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Sequencing, Ubiquitin Proteomics

Genes induced by cAMP  (forskolin  and  dbcAMP)  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced by cAMP (forskolin and dbcAMP) Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay

Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Genes were classified in ascending order of regulation by  PACAP  obtained by real-time PCR.

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Genes were classified in ascending order of regulation by PACAP obtained by real-time PCR.

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Biomarker Discovery, Microarray, Real-time Polymerase Chain Reaction, Control

Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Control

List of genes and gene expression IDs

Journal: Clinical and Experimental Immunology

Article Title: Cytokine responses to exercise and activity in patients with chronic fatigue syndrome: case–control study

doi: 10.1111/cei.13023

Figure Lengend Snippet: List of genes and gene expression IDs

Article Snippet: Thermal cycling was performed using the 7900HT Sequence Detection System (SDS) (Applied Biosystems), and PCR program 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 10 s and 60°C for 1 min. Each reaction included a no‐template control as a negative sample, and each cDNA sample was run in triplicate. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene name Life technologies assay ID 18S Hs99999901_s1 β2M Hs99999907_m1 ATP5β Hs00969567_g1 EIFA42 Hs00756996_g1 GAPDH Hs99999905_m1 UBC Hs00824723_m1 IL‐1β Hs01555413_m1 IL‐6 Hs99999032_m1 IL‐8 Hs01553824_g1 TNF Hs00174128_m1 TGF‐β1 Hs00998133_m1 Open in a separate window IL = interleukin; TGF = transforming growth factor; ATP = adenosine triphosphate; EIF = eukaryotic initiation factors ; GAPDH = glyceraldehyde 3‐phosphate dehydrogenase; UBC = ubiquitin C. List of genes and gene expression IDs Relative expression compared with GAPDH and ATP5B was generated using the 2 –ΔΔCt method, using cycle threshold values (Ct) generated automatically by the 7900HT SDS software.

Techniques: Gene Expression

 VEGF  INHIBITORS

Journal:

Article Title: CORNEAL ANGIOGENIC PRIVILEGE: ANGIOGENIC AND ANTIANGIOGENIC FACTORS IN CORNEAL AVASCULARITY, VASCULOGENESIS, AND WOUND HEALING (AN AMERICAN OPHTHALMOLOGICAL SOCIETY THESIS)

doi:

Figure Lengend Snippet: VEGF INHIBITORS

Article Snippet: Karumanchi and associates 205 demonstrated that endostatin binds to glypicans. table ft1 table-wrap mode="anchored" t5 TABLE 8 caption a7 VEGF INHIBITOR MECHANISM ADVANTAGES SUBJECTS REFERENCES Macugen (pegaptanib, Eyetech) VEGF aptamer (RNA based oligonucleotide which binds VEGF) Direct inhibition of VEGF; intravitreal injection Humans 243 rhu Fab (Genentech) Anti-VEGF monoclonal antibody fragment Small fragment; good penetration; intravitreal injection Monkeys 244 Semaxanib ( SU 5416, Sugen Inc) Competitive inhibitor of Flk-1/KDR > Flt1-1 Specific receptor synthetic inhibitor Humans 245 SU 6668 (Sugen Inc) Flk-1/KDR, PDGFR β and FGFR-1 receptor inhibitor Oral administration Humans 245 Angiozyme (Ribozyme Pharmaceutical) Ribozyme-cleave mRNA for Flt-1 and Flk-1/KDR — Humans 245 CGP41251 Protein kinase C and VEGF receptor kinase inhibition — Humans 246 siRNA targeting VEGF Inhibits VEGF or VEGF receptors Subconjunctival injection, intravenous injection Mice 247 Soluble VEGF receptor sFlt-1 binds VEGF Intravitreal injection Rats 248 VEGF peptide Inhibits VEGF from binding the receptor Intravitreal injection Mice 249 Squalamine(Evizon) Inhibit VEGF mediated endothelial Systematic Human 250 VEGF Trap VEGF Trap binds VEGF IV systematic Human 251 Bevacizumab(Avastin) Anti-VEGF monoclonal antibody(whole antibody) Intravitreal injection Human 252 Open in a separate window VEGF INHIBITORS The proposed mechanisms for endostatin functioning are characterized as follows: (i) endostatin inhibits vascular endothelial tube formation by inhibiting nitric oxide synthase 206 ; (ii) endostatin attenuates vascular endothelial cell migration by downregulating c-myc mRNA expression, which was abrogated with the introduction of the c-myc gene into vascular endothelial cells 207 ; (iii) endostatin induces endothelial cell apoptosis by activating caspase-3 enzymatic activity, reducing antiapoptotic protein BcL-2, and reducing MAP kinases activities 184 ; (iv) endostatin regulates the Wnt signaling pathway by promoting β catenin degradation in the Xenopus system 208 ; (v) endostatin causes G1 arrest of endothelial cells by decreasing the hyperphosphorylation of retinoblastoma gene product and decreasing the mRNA and protein of cyclin D1.

Techniques: Inhibition, Injection, Binding Assay

Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques:

Genes induced by at least one factor,  PACAP,   forskolin,   dbcAMP,  and/or  NGF  Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced by at least one factor, PACAP, forskolin, dbcAMP, and/or NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Ubiquitin Proteomics, Activation Assay, Sequencing, Virus

Genes induced in presence of  NGF  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced in presence of NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Derivative Assay, Ubiquitin Proteomics, Wilms Tumor Assay, Sequencing

Genes induced only by  PACAP  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced only by PACAP Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Sequencing, Ubiquitin Proteomics

Genes induced by cAMP  (forskolin  and  dbcAMP)  Classification of the genes induced by a 6-h treatment with  PACAP  (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or  NGF  (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Genes induced by cAMP (forskolin and dbcAMP) Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay

Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with  PACAP  (100 nM),  forskolin  (25 μ M),  dbcAMP  (1 mM), or  NGF  (100 ng/ml). Genes were classified in ascending order of regulation by  PACAP  obtained by real-time PCR.

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Genes were classified in ascending order of regulation by PACAP obtained by real-time PCR.

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Biomarker Discovery, Microarray, Real-time Polymerase Chain Reaction, Control

Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.

Journal: Molecular pharmacology

Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells

doi: 10.1124/mol.107.044792

Figure Lengend Snippet: Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.

Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4 caption a7 Gene Name Unigene Number GenBank ID PACAP Forskolin dbcAMP NGF Av S.E.M.

Techniques: Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Control