|
ATCC
caption a7 growth Caption A7 Growth, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 growth/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 growth - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp il4 bt03211898 m1 ![]() Gene Exp Il4 Bt03211898 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp il4 bt03211898 m1/product/Thermo Fisher Average 91 stars, based on 1 article reviews
gene exp il4 bt03211898 m1 - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 growth curves ![]() Caption A7 Growth Curves, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 growth curves/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 growth curves - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
l15+glutamax ![]() L15+Glutamax, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/l15+glutamax/product/Thermo Fisher Average 90 stars, based on 1 article reviews
l15+glutamax - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp egfr rn00580398 m1 ![]() Gene Exp Egfr Rn00580398 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp egfr rn00580398 m1/product/Thermo Fisher Average 88 stars, based on 1 article reviews
gene exp egfr rn00580398 m1 - by Bioz Stars,
2026-04
88/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp tgfb1 hs00998133 m1 ![]() Gene Exp Tgfb1 Hs00998133 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp tgfb1 hs00998133 m1/product/Thermo Fisher Average 99 stars, based on 1 article reviews
gene exp tgfb1 hs00998133 m1 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
growth factor function gdnf ![]() Growth Factor Function Gdnf, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/growth factor function gdnf/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
growth factor function gdnf - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Unigene
gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m ![]() Gene Name Unigene Number Genbank Id Pacap Forskolin Dbcamp Ngf Av S.E.M, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m/product/Unigene Average 90 stars, based on 1 article reviews
gene name unigene number genbank id pacap forskolin dbcamp ngf av s.e.m - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp 18s hs99999901 s1 ![]() Gene Exp 18s Hs99999901 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp 18s hs99999901 s1/product/Thermo Fisher Average 99 stars, based on 1 article reviews
gene exp 18s hs99999901 s1 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
caption a7 ingenuity pathways log ![]() Caption A7 Ingenuity Pathways Log, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 ingenuity pathways log/product/Cell Signaling Technology Inc Average 93 stars, based on 1 article reviews
caption a7 ingenuity pathways log - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Gilead Sciences
caption a7 vegf inhibitor mechanism advantages subjects references macugen ![]() Caption A7 Vegf Inhibitor Mechanism Advantages Subjects References Macugen, supplied by Gilead Sciences, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 vegf inhibitor mechanism advantages subjects references macugen/product/Gilead Sciences Average 96 stars, based on 1 article reviews
caption a7 vegf inhibitor mechanism advantages subjects references macugen - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Unigene
gene name ![]() Gene Name, supplied by Unigene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene name/product/Unigene Average 90 stars, based on 1 article reviews
gene name - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Infection and Immunity
Article Title: Divergent Antigen-Specific Cellular Immune Responses during Asymptomatic Subclinical and Clinical States of Disease in Cows Naturally Infected with Mycobacterium avium subsp. paratuberculosis
doi: 10.1128/IAI.00650-19
Figure Lengend Snippet: Real-time PCR bovine cytokine gene target sequences a
Article Snippet: All reactions were performed in triplicate, and data were analyzed with the 2 − Δ Δ C T method. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Cytokine Target sequence Assay ID IL-4 CTTGGCAAGCAAGACCTGTTCTGTG
Techniques: Real-time Polymerase Chain Reaction, Sequencing
Journal: Zebrafish
Article Title: Deriving Cell Lines from Zebrafish Embryos and Tumors
doi: 10.1089/zeb.2013.0866
Figure Lengend Snippet: Variation in Composition of Media for Zebrafish Cell Culture
Article Snippet: Materials Composition of all used solutions and media is listed in . table ft1 table-wrap mode="anchored" t5 Table 2.
Techniques:
Journal: Zebrafish
Article Title: Deriving Cell Lines from Zebrafish Embryos and Tumors
doi: 10.1089/zeb.2013.0866
Figure Lengend Snippet: Media Composition
Article Snippet: Materials Composition of all used solutions and media is listed in . table ft1 table-wrap mode="anchored" t5 Table 2.
Techniques:
Journal: The Journal of Neuroscience
Article Title: Neural Stem/Progenitor Cells Participate in the Regenerative Response to Perinatal Hypoxia/Ischemia
doi: 10.1523/JNEUROSCI.1898-05.2006
Figure Lengend Snippet: Primer sets used in RT-PCR
Article Snippet: Only those genes that were induced or repressed at least twofold in each replication are listed in supplemental (available at www.jneurosci.org as supplemental material ). table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Transcript Primers EGFR (TaqMan)
Techniques: TaqMan Assay
Journal: The Journal of Neuroscience
Article Title: Neural Stem/Progenitor Cells Participate in the Regenerative Response to Perinatal Hypoxia/Ischemia
doi: 10.1523/JNEUROSCI.1898-05.2006
Figure Lengend Snippet: Signaling pathways involved in control of NSP fate are induced by perinatal H/I. Ipsilateral H/I and control hemispheres were dissected out after 48 h of recovery. A, Total RNA was isolated and amplified by qRT-PCR using primers specific for EGFR and Notch1 and normalized to expression of 18S. Values in parentheses indicate CV for the target gene in the sample groups; n = 10 for ipsilateral and contralateral conditions, and n = 4 for sham condition. *p < 0.05 versus sham; †p < 0.05 versus contralateral by pairwise fixed reallocation randomization. Immunostaining for Notch1 was performed on cryostat sections from H/I (B) and control (C) animals. In situ hybridization was performed on cryostat sections of contralateral (D, G), ipsilateral (E, H), and control (F, I) hemispheres using a digoxigenin-labeled RNA probe for Hes5 (D–F) and Hes1 (G–I). Arrows in E delineate the region of increased Hes5 expression. Inset in E shows high-magnification 100× Nomarski image of the Hes5+ region showing a subependymal Hes5+ cell body (arrowhead) with processes (arrow) projecting through the ependyma. There was no evident change in Hes1 expression. Scale bars: inset in E, 4 μm; F, 10 μm. cp, Choroid plexus; V, ventricle.
Article Snippet: Only those genes that were induced or repressed at least twofold in each replication are listed in supplemental (available at www.jneurosci.org as supplemental material ). table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Transcript Primers EGFR (TaqMan)
Techniques: Protein-Protein interactions, Control, Isolation, Amplification, Quantitative RT-PCR, Expressing, Immunostaining, In Situ Hybridization, Labeling
Journal: Inflammatory Intestinal Diseases
Article Title: Hypoxia Reduces the Transcription of Fibrotic Markers in the Intestinal Mucosa
doi: 10.1159/000513061
Figure Lengend Snippet: TaqMan gene expression assays
Article Snippet: Relative mRNA expression was determined by the comparative ∆∆Ct method using beta-actin (ACTB) as the reference gene. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene Full name TaqMan assay ID Human genes TGFβ Transforming growth factor beta
Techniques: Gene Expression, TaqMan Assay
Journal: Expert review of neurotherapeutics
Article Title: Growth factor therapy sequesters inflammation in affording neuroprotection in cerebrovascular diseases
doi: 10.1080/14737175.2016.1184086
Figure Lengend Snippet: Summary of growth factors and their neuroprotective functions.
Article Snippet: *We recognize that there are multiple secondary cell death pathways, but we focus on the inflammation pathway because of its wide therapeutic window, which is the main of this paper. table ft1 table-wrap mode="anchored"
Techniques: Migration, Chemotaxis Assay
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques:
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced by at least one factor, PACAP, forskolin, dbcAMP, and/or NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Ubiquitin Proteomics, Activation Assay, Sequencing, Virus
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced in presence of NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Derivative Assay, Ubiquitin Proteomics, Wilms Tumor Assay, Sequencing
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced only by PACAP Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Sequencing, Ubiquitin Proteomics
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced by cAMP (forskolin and dbcAMP) Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Genes were classified in ascending order of regulation by PACAP obtained by real-time PCR.
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Biomarker Discovery, Microarray, Real-time Polymerase Chain Reaction, Control
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Control
Journal: Clinical and Experimental Immunology
Article Title: Cytokine responses to exercise and activity in patients with chronic fatigue syndrome: case–control study
doi: 10.1111/cei.13023
Figure Lengend Snippet: List of genes and gene expression IDs
Article Snippet: Thermal cycling was performed using the 7900HT Sequence Detection System (SDS) (Applied Biosystems), and PCR program 50°C for 2 min, 95°C for 10 min followed by 40 cycles of 95°C for 10 s and 60°C for 1 min. Each reaction included a no‐template control as a negative sample, and each cDNA sample was run in triplicate. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 Gene name
Techniques: Gene Expression
Journal:
Article Title: CORNEAL ANGIOGENIC PRIVILEGE: ANGIOGENIC AND ANTIANGIOGENIC FACTORS IN CORNEAL AVASCULARITY, VASCULOGENESIS, AND WOUND HEALING (AN AMERICAN OPHTHALMOLOGICAL SOCIETY THESIS)
doi:
Figure Lengend Snippet: VEGF INHIBITORS
Article Snippet: Karumanchi and associates 205 demonstrated that endostatin binds to glypicans. table ft1 table-wrap mode="anchored" t5 TABLE 8
Techniques: Inhibition, Injection, Binding Assay
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Venn diagrams comparing the number of genes induced by PACAP, forskolin, dbcAMP, and/or NGF in PC12 cells after 6 h of treatment. A, diagram comparing the genes induced by PACAP (100 nM), forskolin (25 μM), and/or dbcAMP (1 mM). The experiments were conducted on an array of 15,000 genes, among which 27 seemed reproducibly activated by both PACAP, forskolin, and dbcAMP. B, diagram comparing the genes induced by PACAP (100 nM) and/or NGF (100 ng/ml). The experiments revealed that 20 genes were induced by both PACAP and NGF. C, diagram comparing the genes induced by forskolin (25 μM), dbcAMP (1 mM), and/or NGF (100 ng/ml). The experiments revealed only three genes commonly activated by cAMP stimulators and NGF. It should be noted that these genes were also induced by PACAP (see Tables 2–5).
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques:
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced by at least one factor, PACAP, forskolin, dbcAMP, and/or NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), and NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Ubiquitin Proteomics, Activation Assay, Sequencing, Virus
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced in presence of NGF Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Derivative Assay, Ubiquitin Proteomics, Wilms Tumor Assay, Sequencing
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced only by PACAP Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Sequencing, Ubiquitin Proteomics
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Genes induced by cAMP (forskolin and dbcAMP) Classification of the genes induced by a 6-h treatment with PACAP (100 nM), forskolin (250 nM), dbcAMP (10 mM), and/or NGF (100 ng/ml). Transcripts were classified in decreasing order of magnitude of induction. Some transcripts with a ratio above 1.5 were not included in a particular category for a given treatment, if the data did not also satisfy microarray quality criteria (quality index >0.3). Bold characters indicate genes further investigated by real-time PCR as reported in .
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Microarray, Real-time Polymerase Chain Reaction, Binding Assay, Activation Assay
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Validation of microarray results by real-time PCR mRNA induction for 17 genes, found up-regulated by microarray, after a 6-h treatment with PACAP (100 nM), forskolin (25 μ M), dbcAMP (1 mM), or NGF (100 ng/ml). Genes were classified in ascending order of regulation by PACAP obtained by real-time PCR.
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Biomarker Discovery, Microarray, Real-time Polymerase Chain Reaction, Control
Journal: Molecular pharmacology
Article Title: A cAMP-Dependent, Protein Kinase A-Independent Signaling Pathway Mediating Neuritogenesis through Egr1 in PC12 Cells
doi: 10.1124/mol.107.044792
Figure Lengend Snippet: Time course of induction of PACAP target genes. Time course effect of PACAP (100 nM; red ), forskolin (25 μM; orange), dbcAMP (1 mM; blue), NGF (100 ng/ml; yellow), and medium (green) on the expression of various PACAP target genes. GATA binding protein 2 (Gata2), neuropilin 1 (Nrp1), adenylate cyclase activating polypeptide 1 receptor 1 (Pac-1), annexin A2 (Anx2), homer homolog 2 (Drosophila) (Homer 2), P450 (cytochrome) oxidoreductase (Por). Aldo-keto reductase family 1, member B8 (Akr1b8), villin 2 (Vil2), heat shock 22kDa protein 8 (Hspb8), early growth response 1 (Egr1), glutaredoxin (Glx), protein tyrosine phosphatase 4a1 (Ptp4a1). Growth arrest specific 1 (Gas1), antizyme inhibitor 1 (Azin1), ornithine decarboxylase, structural 1 (Odc), immediate early response 3 (Ier3) and regulator of G-protein signaling 2 (Rgs2). Each time point represents the mean -fold expression (± S.E.M.) compared with the time 0 h as measured by real-time PCR. Data were corrected using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) signal as internal control.
Article Snippet: Bold characters indicate genes further investigated by real-time PCR as reported in . table ft1 table-wrap mode="anchored" t5 TABLE 4
Techniques: Expressing, Binding Assay, Real-time Polymerase Chain Reaction, Control